Review



crispr sequencing  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc crispr sequencing
    Crispr Sequencing, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/pmc12749234-327-26-31?v=Addgene+inc
    Average 93 stars, based on 12 article reviews
    crispr sequencing - by Bioz Stars, 2026-07
    93/100 stars

    Images



    Similar Products

    86
    Benchling Inc crispr guide sequence
    Crispr Guide Sequence, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/pm42098104-245-1-6?v=Benchling+Inc
    Average 86 stars, based on 1 article reviews
    crispr guide sequence - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc crispr cas9 guide sequence
    Crispr Cas9 Guide Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/bio_rxiv__64898__2026__04__22__719209-184-1-6?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    crispr cas9 guide sequence - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    94
    Bethyl sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga
    Sequence Based Reagents Crispr Target Sequence For Camkiiγ Human 5 ́ Gtgctgatcctcatcccaga, supplied by Bethyl, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/pm41634382-214-183-177?v=Bethyl
    Average 94 stars, based on 1 article reviews
    sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    93
    Addgene inc crispr sequencing
    Crispr Sequencing, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/pmc12749234-327-26-31?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    crispr sequencing - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    86
    Sangon Biotech crispr cas9 technology small guide rna sgrna sequences
    Crispr Cas9 Technology Small Guide Rna Sgrna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/pm41070630-162-11-32?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    crispr cas9 technology small guide rna sgrna sequences - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    93
    Addgene inc puromycin sequence
    Puromycin Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/pm41067888-237-29-31?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    puromycin sequence - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    86
    Synthego Inc crispr crrna sequence
    Crispr Crrna Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/bio_rxiv__2025__10__03__680197-183-1-20?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    crispr crrna sequence - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc crispr single guide rna sgrna sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Crispr Single Guide Rna Sgrna Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+sequencing/bio_rxiv__2025__09__23__677920-51-0-17?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    crispr single guide rna sgrna sequences - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Control, Knockdown

    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with tiratricol (0.1 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). To prevent infinitesimal values that would be generated by the regression models, each thrombosis grade group was incremented by one count across all treatment groups. ****: p < 0.0001, ***: p < 0.001. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with tiratricol (0.1 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). To prevent infinitesimal values that would be generated by the regression models, each thrombosis grade group was incremented by one count across all treatment groups. ****: p < 0.0001, ***: p < 0.001. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Generated, Control, Knockdown

    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and observed at 5 dpf. Thrombosis grades were collected simultaneously with the TTO evaluations, ensuring consistent sample use as presented in . Statistical analyses were performed using proportional odds logistic regression ( polr ) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, *: p < 0.05. - proc : genetic thrombosis line ( proc −/− ::fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and observed at 5 dpf. Thrombosis grades were collected simultaneously with the TTO evaluations, ensuring consistent sample use as presented in . Statistical analyses were performed using proportional odds logistic regression ( polr ) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, *: p < 0.05. - proc : genetic thrombosis line ( proc −/− ::fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Control, Knockdown

    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf, and mestranol (25 µM) at 4 dpf, followed by assessment of laser-mediated endothelial injury at 5 dpf. Increased TTO observed in wild-type embryos treated with thyroid hormone was diminished upon thr knockdown, indicating involvement of thyroid receptor signaling. Increased TTO levels were still present in the L-thyroxine-mestranol combination groups. ****: p<0.0001, ***: p<0.001, **: p<0.01, *: p<0.05, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf, and mestranol (25 µM) at 4 dpf, followed by assessment of laser-mediated endothelial injury at 5 dpf. Increased TTO observed in wild-type embryos treated with thyroid hormone was diminished upon thr knockdown, indicating involvement of thyroid receptor signaling. Increased TTO levels were still present in the L-thyroxine-mestranol combination groups. ****: p<0.0001, ***: p<0.001, **: p<0.01, *: p<0.05, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Knockdown, Control

    After CRISPR-mediated individual knockdown of each canonical thyroid hormone receptor (- thraa , - thrab , and - thrb ) or combination (- thr ), embryos were co-treated with L-thyroxine (3 µM) and mestranol (25 µM) at 4 dpf and evaluated 24 hours later. Magenta borders indicate mestranol treated groups. ****: p < 0.0001, *: p < 0.05, ns: not significant. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: After CRISPR-mediated individual knockdown of each canonical thyroid hormone receptor (- thraa , - thrab , and - thrb ) or combination (- thr ), embryos were co-treated with L-thyroxine (3 µM) and mestranol (25 µM) at 4 dpf and evaluated 24 hours later. Magenta borders indicate mestranol treated groups. ****: p < 0.0001, *: p < 0.05, ns: not significant. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Knockdown